Usage examples
Binning modes
SemiBin2 supports three different binning modes, with different tradeoffs.
Single-sample binning
Single sample binning means that each sample is assembled and binned independently.
This mode allows for parallel binning of samples and avoids cross-sample chimeras, but it does not use co-abundance information across samples.
Using a prebuilt model means that SemiBin2 can return results in a few minutes.
Co-assembly binning
Co-assembly binning means samples are co-assembled first (as if the pool of samples were a single sample) and then bins are constructed from this pool of co-assembled contigs.
This mode can potentially generate better contigs (especially from species that are at a low abundance in any individual sample) and uses co-abundance information which can lead to better bins. On the other hand, co-assembly can lead to inter-sample chimeric contigs and binning based on co-assembly does not retain sample-specific variation.
It is most appropriate when the samples are very similar and can be expected to contain overlapping sets of organisms (e.g., a time-series from the same habitat).
Multi-sample binning
With multi-sample binning, multiple samples are assembled and binned individually, but information from multiple samples is used together. This mode can use co-abundance information and retain sample-specific variation at the same time. As we document in the SemiBin1 and SemiBin2 manuscripts, this mode often returns the highest-number of bins (particularly for complex environments, such as soil).
However, it has increased computational costs. In particular, prebuilt models cannot be used.
This mode is implemented by concatenating the contigs assembled from the individual samples together and then mapping reads from each sample to this concatenated database.
Concatenating the inputs can be done with the concatenate_fasta
subcommand.
Single-sample binning
Inputs required: S1.fa
(contig file in FASTA format) and S1.sorted.bam
(short reads mapped to the contigs, sorted).
[How to generate inputs to SemiBin]
Easy single binning mode
There are two options.
1. Using a pre-trained model. This is the fastest option and should work the best if you have metagenomes from one of our prebuilt habitats (alternatively, you can use the global
"habitat" which combines all of them).
SemiBin2 single_easy_bin \
--environment human_gut \
-i S1.fa \
-b S1.sorted.bam \
-o output
Binning assemblies from long reads:
SemiBin2 single_easy_bin \
--environment human_gut \
--sequencing-type long_read \
-i S1.fa \
-b S1.sorted.bam \
-o output
Supported habitats are (names should be self-explanatory, except global
which is a generic model):
human_gut
dog_gut
ocean
soil
cat_gut
human_oral
mouse_gut
pig_gut
built_environment
wastewater
chicken_caecum
global
Figure 5 in the SemiBin1 manuscript shows details of how well each habitat-specific model performs (except for the chicken_caecum
model which was contributed after publication by Florian Plaza Oñate and is available since version 1.2).
2a. Learn a new model (self-supervised mode). You can also learn a new model for your data. It will take a bit of time, but may produce better results:
SemiBin2 single_easy_bin \
--self-supervised \
-i S1.fa \
-b S1.sorted.bam \
-o output
The Supplemental Tables 5 & 6 in the SemiBin1 manuscript contain a lot more information with respect to the computational trade-offs.
If you have a lot of samples that are similar to each other while not fitting into any of our builtin trained models, you can also build your own model from a subset of them (see [training a SemiBin model])
Advanced single-sample binning workflows
The basic pipeline using SemiBin2 for either single-sample and co-assembly modes:
- generate data.csv and data_split.csv (used in training) for every sample,
- train the model for every sample, and
- bin the contigs with the model trained from the same sample.
You can run the individual steps by yourself, which can enable using compute clusters to make the binning process faster.
In particular, single_easy_bin
includes the following steps:
generate_data_single
train_self
bin_short
orbin_long
multi_easy_bin
includes
1. generate_data_multi
2. train_self
(if needed)
3. bin_short
or bin_long
(1) Generate features (data.csv/data_split.csv
files)
SemiBin2 generate_sequence_features_single -i S1.fa -b S1.sorted.bam -o S1_output
(3) Train a model (if desired)
SemiBin2 train_self \
--data S1_output/data.csv \
--data-split S1_output/data_split.csv \
-o S1_output
This step heavily benefits from having access to a GPU.
It will attempt to auto-detect whether one is available, but you can use the --engine
argument to specify whether SemiBin2 should use CPU or GPU processing.
This step can be skipped if you want to use a pretrained model.
(4) Bin
SemiBin2 bin_short \
-i S1.fa \
--model S1_output/model.pt \
--data S1_output/data.csv \
-o S1_output
or
SemiBin2 bin_long \
-i S1.fa \
--model S1_output/model.pt \
--data S1_output/data.csv \
-o S1_output
or, to use one of our built-in models (see above for the list of available models), you replace the --model
argument with the --environment
argument:
SemiBin2 bin_short \
-i S1.fa \
--environment human_gut \
--data S1_output/data.csv \
-o S1_output
or
SemiBin2 bin_long \
-i S1.fa \
--environment human_gut \
--data S1_output/data.csv \
-o S1_output
SemiBin2(pretrain)
Another suggestion is that you can pre-train a model from part of your dataset, which can provide a balance as it is faster than training for each sample while achieving better results than a pre-trained model from another dataset (see the SemiBin1 manuscript for more information).
If you have S1.fa
, S1/data.csv
, S1/data_split.csv
, S1/cannot/cannot.txt
; S2.fa
, S2/data.csv
, S2/data_split.csv
, S2/cannot/cannot.txt
; S3.fa
, S3/data.csv
, S3/data_split.csv
, S3/cannot/cannot.txt
.
You can train the model from 3 samples.
SemiBin2 train \
-i S1.fa S2.fa S3.fa \
--data S1/data.csv S2/data.csv S3/data.csv \
--data-split S1/data_split.csv S2/data_split.csv S3/data_split.csv \
-c S1/cannot.txt s2/cannot.txt S3/cannot.txt \
--mode several \
-o S1_output
Co-assembly binning
Input: contig.fa
and S1.sorted.bam
, S2.sorted.bam
, S3.sorted.bam
,...
Easy co-assembly binning mode
To a large extent, co-assembly binning is just like single-sample binning. The major difference is that when generating features, we can use multiple samples. Unfortunately, this also means that prebuilt models cannot be used (because models depend on the number of samples, one would need to pre-train a model for each possible input sample input number).
SemiBin2 single_easy_bin \
-i contig.fa \
-b S1.sorted.bam S2.sorted.bam S3.sorted.bam \
-o co-assembly_output
Advanced co-assembly binning workflows
(1) Generate data.csv/data_split.csv
SemiBin2 generate_sequence_features_single \
-i contig.fa \
-b S1.sorted.bam S2.sorted.bam S3.sorted.bam \
-o contig_output
Note that we use the generate_sequence_features_single
mode because co-assembly and single-sample modes are very similar.
(2) Train
SemiBin2 train_self \
--data contig_output/data.csv \
--data-split contig_output/data_split.csv \
-o contig_output
SemiBin2 will attempt to detect a GPU and fallback to CPU if none is found, but you can use the --engine
argument to specify which one to use.
Having access to a GPU can speed up this mode.
(3) Bin
SemiBin2 bin_short \
-i contig.fa \
--model contig_output/model.pt \
--data contig_output/data.csv \
-o output
Multi-sample binning
Multi-sample binning requires more complex steps to prepare input data as well as more computation but can also result in more bins (particularly in complex habitats). See Figure 3b in the SemiBin1 manuscript for a comparison of multi sample vs. single sample.
Inputs:
- original FASTA files: S1.fa
, S2.fa
, S3.fa
, S4.fa
, and S5.fa
(we will assume that there are 5 samples)
- combined FASTA file: concatenated.fa.gz
(can be generated with the concatenate_fasta
SemiBin2 subcommand)
- mapped reads to the combined FASTA file: S1.sorted.bam
, S2.sorted.bam
, S3.sorted.bam
, S4.sorted.bam
, and S5.sorted.bam
.
Generating concatenated.fa
SemiBin2 concatenate_fasta \
--input-fasta S1.fa S2.fa S3.fa S4.fa S5.fa \
--output output
This will produce the file output/concatenated.fa
Technical note on the format of concatenated.fa
: every contig is renamed to the name <sample_name>:<original_contig_name>
, where :
is the default separator (it can be changed with the --separator
argument, which must then be passed to all the commands that use it).
Using the concatenate_fasta
subcammand will make sure that sample names are unique and the separator does not introduce confusion when splitting (that is, that the separator is not already used in the contig or sample names).
Otherwise, you can also prepare the file yourself.
For example:
>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAAT
Afterwards, you should map each sample separately to the concatenated FASTA file to produce the respective sorted.bam
file.
Easy multi binning mode
SemiBin2 multi_easy_bin \
-i concatenated.fa \
-b S1.sorted.bam S2.sorted.bam S3.sorted.bam S4.sorted.bam S5.sorted.bam \
-o multi_output
or for long reads:
SemiBin2 multi_easy_bin \
--sequencing-type long_read \
-i concatenated.fa \
-b S1.sorted.bam S2.sorted.bam S3.sorted.bam S4.sorted.bam S5.sorted.bam \
-o multi_output
Advanced multi-sample binning workflows workflows
As with the other modes, the multi_easy_bin
subcommand encapsulates a series of steps that can also be run independently for more control.
They can also be parallelized in a compute cluster, for example.
(1) Generate data.csv/data_split.csv
SemiBin2 generate_sequence_features_multi \
-i concatenated.fa.gz \
-b S1.sorted.bam S2.sorted.bam S3.sorted.bam S4.sorted.bam S5.sorted.bam \
-o output
(2) Train
Training is performed independently for each sample (thus, could be parallelized), but uses the input features that account for all the sample data:
for sample in S1 S2 S3 S4 S5 ; do
SemiBin2 train_self \
--data multi_output/samples/${sample}/data.csv \
--data-split multi_output/samples/${sample}/data_split.csv \
--output ${sample}_output
done
The same comments about GPU access that applied to the other modes, apply here.
(3) Bin
There are two subcommands, depending on whether you want to use the binning mode for short reads (bin_short
) of for long reads (bin_long
), so that this would be either
for sample in S1 S2 S3 S4 S5 ; do
SemiBin2 bin_short \
-i ${sample}.fa \
--model ${sample}_output/model.pt \
--data multi_output/samples/${sample}/data.csv \
-o output
done
or
for sample in S1 S2 S3 S4 S5 ; do
SemiBin2 bin_long \
-i ${sample}.fa \
--model ${sample}_output/model.pt \
--data multi_output/samples/${sample}/data.csv \
-o output
done
Each sample is binned independently. This step is relatively fast.
Running SemiBin in semi-supervised mode
Note⚠️: This is generally not needed as semi-supervised mode is not recommended anymore!
See the semi-supervised mode page for more information.
Running SemiBin with strobealign-aemb
This has its own dedicated page.